Skip to main content

Table 1 Sequences of primers used in qPCR

From: MSI-1436 improves EMS adipose derived progenitor stem cells in the course of adipogenic differentiation through modulation of ER stress, apoptosis, and oxidative stress

Gene Primer Sequence 5′–3′ Amplicon length (bp) Accession no.
PPARγ F: TCCCTGTTTGTGTACAGCCTT 191 XM_014846252.1
R: CTCCATGGCTGATTTCCCCT
ADIPOQ F: GGAGATCCAGGTCTTGTTGG 162 XM_014843352.1
R: TCGGGTCTCCAATCCTACAC
Lep F: CACACGCAGTCAGTCTCCTC 176 XM_014854289.1
R: CGGAGGTTCTCCAGGTCAT
CEBPA F: TCCCGGAGGGACCAAAGTTA 116 XM_023649498.1
R: CTCACATTGCACAAGGCACC
AKT1 F: CCAGGCTTGTGGTTGTCATCCT 108 XM_023628568.1
R: TTCTTGAGGAGGAAGTACCGGG
AKT2 F: CAGGAAACACAGGGAGCGG 160 XM_023649744.1
R: GACACGCTGTCACCTAGCTC
SHBG F: GGCAACCTTTAACGCTCCAC 274 XM_023653464.1
R: GACAGGCTTTTGTCCTGGGT
AHSG F: TGATGACCCCGAAACAGAGC 80 XM_005601872.3
R: CGTGCTTGTAGCCCTGATGA
p53 F: TACTCCCCTGCCCTCAACAA 252 U37120.1
R: AGGAATCAGGGCCTTGAGGA
Bax F: TTCCGACGGCAACTTCAACT 204 XM_005596728.1
R: GGTGACCCAAAGTCGGAGAG
Bcl-2 F: TTCTTTGAGTTCGGTGGGGT 164 XM_014843802.1
R: GGGCCGTACAGTTCCACAA
p21 F: GAAGAGAAACCCCCAGCTCC 241 XM_003365840.2
R: TGACTGCATCAAACCCCACA
Casp-3 F: GGCAGACTTCCTGTATGCGT 167 XM_023630401.1
R: CCATGGCTACCTTGCGGTTA
Casp-9 F: TCCTACTCCACCTTCCCAGG 150 XM_005607504.3
R: CTCCGAAACAGCGTGAGCTA
PERK F: GTGACTGCAATGGACCAGGA 283 XM_014852775.1
R: TCACGTGCTCACGAGGATATT
CHOP F: AGCCAAAATCAGAGCCGGAA 272 XM_014844003.1
R: GGGGTCAAGAGTGGTGAAGG
IRE1 F: GAATCAGACGAGCACCCGAA 300 XM_023652216.1
R: TTTCTTGCAGAGGCCGAAGT
ATF6 F: CAGGGTGCACTAGAACAGGG 161 XM_023640315.1
R: AATGTGTCTCCCCTTCTGCG
XBP1 F: CGATCGAGTACTGTTGCCCT 299 XM_014742035.2
R: GACGTTTGTCCAGTGACCCT
SOD1 (Cu/Zn SOD) F: CATTCCATCATTGGCCGCAC 130 NW_001867397.1
R: GAGCGATCCCAATCACACCA
SOD2 (Mn SOD) F: GGACAAACCTGAGCCCCAAT 125 NW_001867408.1
R: TTGGACACCAGCCGATACAG
CAT F: ACCAAGGTTTGGCCTCACAA 112 XM_014851065.1
R: TTGGGTCAAAGGCCAACTGT
GAPDH F: GATGCCCCAATGTTTGTGA 250 NM_001163856.1
R: AAGCAGGGATGATGTTCTGG
  1. Sequences: amplicon length and access numbers of the primer sets. PPARγ peroxisome proliferator-activated receptor gamma, ADIPOQ adiponectin, Lep leptin, CEBPA CCAAT/enhancer-binding protein alpha, AKT1 serine-threonine protein kinase 1, AKT2 serine-threonine protein kinase 2, SHBG sex hormone binding globulin, AHSG alpha 2-HS glycoprotein, p53 tumor suppressor p53, Bcl-2 B cell lymphoma 2, Bax BCl-2 associated X protein, p21 cyclin-dependent kinase inhibitor 1, Casp-3 caspase 3, Casp-9 caspase 9, PERK PRKR-like endoplasmic reticulum kinase, CHOP C/EBP homologous protein, ATF6 activating transcription factor 6, IRE1 inositol-requiring enzyme, XBP1 X-box binding protein 1, SOD1 (Cu/Zn SOD) copper-zinc-dependant superoxide dismutase (CuZnSOD), SOD2 (Mn SOD) manganese-dependent superoxide dismutase (MnSOD), CAT catalase, GADPH glyceraldehyde 3-phosphate dehydrogenase