Skip to main content

Table 1 Primers for the RT-qPCR

From: GDF-5 promotes epidermal stem cells proliferation via Foxg1-cyclin D1 signaling

Primer name Sequence (5′ to 3′) Length Tm (°C)
GAPDH-F GGTTGTCTCCTGCGACTTCA 20 57.5
GAPDH-R TGGTCCAGGGTTTCTTACTCC 21 56.5
Foxa1-F TTACAAGGATGCCTCTCCA 19 52.6
Foxa1-R TGGCTCTCTGAAAAGCAAG 19 52.4
Foxc1-F GGATCGGCTTGAACAACT 18 52.4
Foxc1-R AGAGTGCCGGGAATAGG 17 54.0
Foxd3-F CGTAGAGAAGCGTCGAGGA 19 56.6
Foxd3-R GGCAAAGGAGGTGTGAGTG 19 56.5
Foxg1-F AACGGGCTGAGTGTGGA 17 58.8
Foxg1-R CAGGGGTTGAGGGAGTAGG 19 57.6
Foxo3-F GAGGATTCGGCCATGCT 17 55.4
Foxo3-R TTCCTTGGTTGCCCAGAG 18 55.1
Foxp1-F TGCGCTGGACGATAGAA 17 53.4
Foxp1-R ATGCAGGTGGGTCATCA 17 53.5
Cyclin C-F ATGCTTGGTAATTGATTTGCT 21 49.5
Cyclin C-R CAGGGGTTGAGGGAGTAGG 19 57.6
Cyclin D1-F ACCCTGACACCAATCTCCT 19 55.6
Cyclin D1-R CTCCTTCTGCACGCACTT 18 55.6
Cyclin D2-F CCGTTCTTGGCTCTGGT 17 55.1
Cyclin D2-R AGGCACCTGTTGAAACTGA 19 53.9
Cyclin D3-F AAACCACGCCCCTGACT 17 57.2
Cyclin D3-R AGGTCCCACTTGAGCTTCC 19 57.4
Cyclin E-F CCCAAGTCCTGAGCCAT 17 54.7
Cyclin E-R TCGGAGCCACCTTCTTC 17 54.5