Skip to main content

Table 1 Primer sequences used for real-time qPCR

From: Human foreskin-derived dermal stem/progenitor cell-conditioned medium combined with hyaluronic acid promotes extracellular matrix regeneration in diabetic wounds

Gene Species Forward primer Reverse primer
ALP Human TACAAGCACTCCCACTTCATC AGACCCAATAGGTAGTCCACAT
BMP-2 Human GAAGAACTACCAGAAACGAGTG GGTGATGGAAACTGCTATTG
Osx Human CAGTTGATAGGGTTTCTCTTGTA CATAGGACTTGAGGTTTCACAG
OCN Human CTGTGACGAGTTGGCTGAC AGCAGAGCGACACCCTAGA
OPN Human CATTCCGATGTGATTGATAGTC CTTCCTTACTTTTGGGGTCTAC
C/EBP α Human CCCTCAGCCTTGTTTGTACT AAAATGGTGGTTTAGCAGAGA
FABP4 Human AGAGAAAACGAGAGGATGATAA TTCAATGCGAACTTCAGTC
PPAR-γ2 Human GCAGTGGGGATGTCTCATAAT CAGCGGACTCTGGATTCAG
SREBP1 Human AACACAGCAACCAGAAACTCA GTCCTCCACCTCAGTCTTCAC
COL 2 Human TGGACGCCATGAAGGTTTTCT TGGGAGCCAGATTGTCATCTC
Aggrecan Human GTGCCTATCAGGACAAGGTCT GATGCCTTTCACCACGACTTC
SOX-9 Human AGCGAACGCACATCAAGAC CTGTAGGCGATCTGTTGGGG
COL 1 Human AGGGCCAAGACGAAGACATC GTCGGTGGGTGACTCTGAGC
COL3 Human AAGGGCAGGGAACAACT ATGAAGCAGAGCGAGAAG
MMP-1 Human GGAGCTGTAGATGTCCTTGGGGT GCCACAACTGCCAAATGGGCTT
MMP-3 Human AGGACAAAGCAGGATCACAGTTG CCTGGTACCCACGGAACCT
FN Human TCTCCTGCCTGGTACAGAATAT GGTCGCAGCAACAACTTCCAGGT
α-SMA Human GCTACTCCTTCGTGACCACAG GCCGTCGCCATCTCGTTCT
TGF-β1 Human TACTACGCCAAGGAGGTCAC GAGAGCAACACGGGTTCAG
β-actin Human GGCACTCTTCCAGCCTTCC GAGCCGCCGATCCACAC