Skip to main content

Table 2 The primer sequences for RT-qPCR

From: MicroRNA-495 confers inhibitory effects on cancer stem cells in oral squamous cell carcinoma through the HOXC6-mediated TGF-β signaling pathway

GeneSequence (5′-3′)
miR-495Forward: GCGCGTGAGCAGGCTGGAGAAATT
Reverse: AAACAAACATGGTGCA
HOXC6Forward: ACAGACCTCAATCGCTCAGGA
Reverse: AGGGGTAAATCTGGATACTGGC
TGF-βForward: CAACGCCATCTATGAGAAAACC
Reverse: AAGCCCTGTATTCCGTCTCC
TGFβRIForward: ATTACCTGGACATCGGCA AC
Reverse: TTGGGCACCACATCATAGAA
Smad4Forward: GTGGCTGGTCGGAAAGGATT
Reverse: ACTGGCAGGCTGACTTGTGG
TGFβRIIForward: ACTTGACCTGTTGCCTGTGTGAC
Reverse: CTGGCTTCAACGCCTTTCACCTCA
N-cadherinForward: TCATTGCCATCCTGCTCTGCAT
Reverse: AGTTGTTTGGCCTGGCGTTCTT
VimentinForward: AAAGTGTGGCTGCCAAGAACCT
Reverse: ATTTCACGCATCTGGCGTTCCA
E-cadherinForward: TTAGGTTAGAGGGTTATCGCGT
Reverse: TAACTAAAAATTCACCTACCGACC
U6Forward: CGCTTCACGAATTTGCGTGTCAT
Reverse: GCTTCGGCAGCACATATACTAAAAT
GAPDHForward: ACAGTCAGCCGCATCTTCTT
Reverse: GACAAGCTTCCCGTTCTCAG
  1. RT-qPCR reverse transcription quantitative polymerase chain reaction, miR-495 microRNA-495, HOXC6 homeobox C6, TGF-β transforming growth factor β, TGF-βRI transforming growth factor βreceptor I, TGF-βRII transforming growth factor βreceptor II, Smad4 sma and mother against ddp four, GAPDH glyceraldehyde-3-phosphate dehydrogenase, U6 U6 snRNA