Skip to main content

Table 1 Primers for toll-like receptor 1–10

From: Biological characteristics of stem cells derived from burned skin—a comparative study with umbilical cord stem cells

Target Forward primer Reverse primer
TLR 1 GCACCCCTACAAAAGGAATCTG GGCAAAATGGAAGATGCTAGTCA
TLR 2 CTGGTAGTTGTGGGTTGAAGCA GATTGGAGGATTCTTCCTTGGA
TLR 3 TTAAAGAGTTTTCTCCAGGGTGTTTT AATGCTTGTGTTTGCTAATTCCAA
TLR 4 CCCCTTCTCAACCAAGAACC ATTGTCTGGATTTCACACCTGGAT
TLR 5 TGCTAGGACAACGAGGATCATG GAGGTTGCAGAAACGATAAAAGG
TLR 6 AGGCCCTGCCCATCTGTAA GCAATTGGCAGCAAATCTAATTT
TLR 7 GCTATTGGGCCCATCTCAAG TCCACATTGGAAACACCATTTTT
TLR 8 TCAGTGTTAGGGAACATCAGCAA AACATGTTTTCCTTTTTAGTCTCCTTTC
TLR 9 GGGAGCTACTAGGCTGGTATAAAAATC GCTACAGGGAAGGATGCTTCAC
TLR 10 TTTACTCTGGGACGACCTTTTCC ATAAGCCTTACCACCAAAAGTCACA