Skip to main content

Table 1 Primers for qRT-PCR and oligonucleotide

From: RETRACTED ARTICLE: MiR-34a inhibitor protects mesenchymal stem cells from hyperglycaemic injury through the activation of the SIRT1/FoxO3a autophagy pathway

Name Sequence
qPCR
 miR-34a 5′-UGGCAGUGUCUUAGCUGGUUGUU-3′
 U6 F 5′-CCTGCTTCGGCAGCACA-3′
R 5′-AACGCTTCACGAATTTGCGT-3′
  F 5′- CCCAGCACAATGAAGATCAAGATCAT-3′
R 5′- ATCTGCTGGAAGGTGTACAGCGA-3′
Oligonucleotide
 miR-34a mimic UGGCAGUGUCUUAGCUGGUUGUU CAACCAGCUAAGACACUGCCAUU
 Negative Control (NC) mimic UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT
 miR-34a inhibitor UGGCAGUGUCUUAGCUGGUUGUU
 NC inhibitor CAGUACUUUUGUGUAGUACAA
 siRNA-SIRT1 GCACCGAUCCUCGAACAAUTT AUUGUUCGAGGAUCGGUGCTT
 siRNA-NT UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT