Skip to main content

Table 1 Sequences of the primers used for reverse transcription quantitative polymerase chain reaction

From: Apoptosis repressor with caspase recruitment domain (ARC) promotes bone regeneration of bone marrow-derived mesenchymal stem cells by activating Fgf-2/PI3K/Akt signaling

Genes Forward primer Reverse primer
Actin TGAAGTGTGACGTGGACATC GGAGGAGCAATGATCTTGAT
ARC ACAGCCTTGGGAAGTGAGAC GTCCAGAGAGAAGCCAGACAA
ALP TCAAGCCAAACACAAACAGC GGAGCCACAATCCAGTCATT
OCN GCGAGACATCAAGGAGAAGC CCAATAAAGGAAGGCTGGAA
Runx2 GAAGAGGAGGAGGAAGAAGAGG TCCATAGCCCAGTGTTGTAGC
Fgf-2 CAACACTTACCGGTCACGGA CCCCGTTTTGGATCCGAGTT