Skip to main content

Table 1 Primer sequences in the quantitative real-time polymerase chain reaction analysis of osteogenesis- and adipogenesis-related mRNAs

From: miR-133a silencing rescues glucocorticoid-induced bone loss by regulating the MAPK/ERK signaling pathway

Gene Forward primer Reverse primer
Runx2 GCCTCTTCAGCACAGTGACA CATTCCGGAGCTCAGCAGAA
ALP ACCGCTTCCCATATGTGGCT TGCACCAGATTCTTCCCGTC
aP2 TGACAGGAAAGTCAAGAGCACC GCCTTTCATGACGCATTCCA
PPARĪ³ CTTGCAGTGGGGATGTCTCAT AGCAAACCTGGGCGGTTGAT
FGFR1 TCAGATGCTCTCCCCTCCTC CTACGGGCATACGGTTTGGT
GAPDH CCATGACAACTTTGGTATCGTGGAA GGCCATCACGCCACAGTTTC