Skip to main content

Table 1 Specific primers used in this study

From: Sinusoidal electromagnetic fields accelerate bone regeneration by boosting the multifunctionality of bone marrow mesenchymal stem cells

Gene (rat)   Primer sequences
Smad1 Forward:
Reverse:
CAGCCCTTTTCAGATGCCAG
ACTGCTTGAACATCTCCTCTATTG
Smad4 Forward:
Reverse:
GGTCCGTAGGTGGAATAGCC
AATCCAGCACGGGGTTTCTT
Smad5 Forward:
Reverse:
CTGCCAATAACAAGAGCCGC
ACCTCCCCACCAACGTAGTA
Smad8 Forward:
Reverse:
AACAACCAGCTCTTCGCCC
CTGGCGATGATACTCGGCTC
ACVR1 Forward:
Reverse:
GACTGTACGCTGTCAGGCTC
CCATACTCGGGGAAGGGAGA
BMPR1A Forward:
Reverse:
GCACCAGAGGACACCTTACC
GCTGGGCTTTTGGTGAATCC
BMPR1B Forward:
Reverse:
TTCTTCACCACGGAGGAAGC
AGTCCAAGACCCAGTCCCTT
BMPR2 Forward:
Reverse:
GAAGAGCACAGAGGCCCAAT
CCTGATTTGCCATCCTGCGT
BMP2 Forward:
Reverse:
GAAGAAATTGCAAAATGAAGACTGC
CGCCATCTCCATTTTCTTCCG
BSP Forward:
Reverse:
GAAGAAATTGCAAAATGAAGACTGC
CGCCATCTCCATTTTCTTCCG
Runx2 Forward:
Reverse:
CTACTCTGCCGAGCTACGAAAT
TCTGTCTGTGCCTTCTTGGTTC
OPN Forward:
Reverse:
CCAGCCAAGGACCAACTACA
CCAAGTGGCTACAGCATCTGA
OCN Forward:
Reverse:
GGAGGGCAGTAAGGTGGTGA
GAAGCCAATGTGGTCCGC
VEGFA Forward:
Reverse:
GGCCATCAAGCTCTCTCCTC
CACACACAGCCAAGTCTCCT
FGF2 Forward:
Reverse:
TGTCCATCAAGGGAGTGTGTG
TCGTTTCAGTGCCACATACCA
VWF Forward:
Reverse:
GGTGGAGGAAGACCCCATTG
GATGTCCAGGTATGGCTCGG
eNOS Forward:
Reverse:
GAAGGTCGGTGTGAACGGAT
CCCATTTGATGTTAGCGGGAT
GAPDH Forward:
Reverse:
GAAGGTCGGTGTGAACGGAT
CCCATTTGATGTTAGCGGGAT