Skip to main content

Table 2 Primer sequence

From: Exosomal miR-100-5p inhibits osteogenesis of hBMSCs and angiogenesis of HUVECs by suppressing the BMPR2/Smad1/5/9 signalling pathway

Gene name Primer sequence
ALP F CACGGCGTCCATGAGCAGAAC
R CAGGCACAGTGGTCAAGGTTGG
COL1A1 F TGTTGGTCCTGCTGGCAAGAATG
R GTCACCTTGTTCGCCTGTCTCAC
RUNX2 F TCCGCCACCACTCACTACCAC
R GGAACTGATAGGACGCTGACGAAG
╬▓-actin F TGGCTCTAACAGTCCGCCTAG
R AGTGCGACGTGG ACATCCG
OCN F GGACCCTCTCTCTGCTCACTCTG
R ACCTTACTGCCCTCCTGCTTGG
PPAR╬│ F CCATCGAGGACATCCAAGACAACC
R GTGCTCTGTGACAATCTGCCTGAG
VEGFA F GCCTTGCCTTGCTGCTCTACC
R CTTCGTGATGATTCTGCCCTCCTC
FGF2 F GAAGAGCGACCCTCACATCAAGC
R CCAGGTAACGGTTAGCACACACTC
OPN F CCAGCCAAGGACCAACTACA
R GCTGGCAGTGAAGGACTCAT
miR-100-5p F GGAACCCGTAGATCCGAACTTGTG
R AACGCTTCACGAATTTGCGT
U6 F CTCGCTTCGGCAGCACA
R AACGCTTCACGAATTTGCGT