Skip to main content

Table 1 Primer sequences

From: Umbilical cord blood plasma-derived exosomes as a novel therapy to reverse liver fibrosis

Target gene Primer sequence (5–3′) Amplicon size (bp)
MMP-13 For: AACCCTAAGCACCCCAAAACA
Rev: GGTCAAAAACAGTTCAGGCTCAA
150 bp
Pro-Collagen type I-α1 For: CCAGCGGTGGTTATGACTTCA
Rev: GCTGCGGATGTTCTCAATCTG
167 bp
MMP-2 For: ACCATGCGGAAGCCAAGAT
Rev: GCCCGAGCAAAAGCATCAT
155 bp
MMP-9 For: CCTACTGCTGGTCCTTCTG
Rev: GGCTTCCTCCGTGATTCG
157 bp
TIMP-1 For: CATGGAAAGCCTCTGTGGAT
Rev: CTCAGAGTACGCCAGGGAAC
132 bp
TIMP-2 For: CACAGACTTCAGCGAATGGA
Rev: CCAGCATGAGACCTCACAGA
124 bp
TGF-β For: TTGCCCTCTACAACCAACACAA
Rev: GGCTTGCGACCCACGTAGTA
103 bp