Skip to main content

Table 1 Primer pairs sequences against osteoclast gene used in qPCR

From: DZNep promotes mouse bone defect healing via enhancing both osteogenesis and osteoclastogenesis

Mouse gene Forward 5′ → 3′ Reverse 5′ → 3′
Trap/Acp5 CAAAGAGATCGCCAGAACCG GAGACGTTGCCAAGGTGATC
Ctsk CTTCCAATACGTGCAGCAGA TCTTCAGGGCTTTCTCGTTC
Atp6v0d2 GCAGAGCTGTACTTCAATGTGG TAGTCCGTGGTCTGGAGATG
Calcr TCTGCGTTCCTGAGAACACC AAGGCGCTCTAATGGCACTT
Nfatc1 TGCTCCTCCTCCTGCTGCTC GCAGAAGGTGGAGGTGCAGC
c-Fos CCAGTCAAGAGCATCAGCAA AAGTAGTGCAGCCCGGAGTA
Runx2 TGGCCGGGAATGATGAGAAC GGATGAGGAATGCGCCCTAA
Alpl GGGCATTGTGACTACCACTCG CCTCTGGTGGCATCTCGTTAT
Ocn GCGCTCTGTCTCTCTGACCT TTTGTAGGCGGTCTTCAAGC
Opn TTTGTAGGCGGTCTTCAAGC GTGAGATTCGTCAGATTCATCCG
Col1a1 TAAGGGTCCCCAATGGTGAGA GGGTCCCTCGACTCCTACAT
Wnt1 ATAGCCTCCTCCACGAACCT GATGAACGCTGTTTCTCGGC
Wnt4 GAGCAACTGGCTGTACCTGG GGAACTGGTACTGGCACTCC
Wnt6 GGTCACTCAAGCCTGTTCCA CCGAAGTCCACATCGTCTCC
Wnt10a CTGAACACCCGGCCATACTTC CTGAACACCCGGCCATACTTC
Foxc1 CACTCGGTGCGGGAAATGT GTGCGGTACAGAGACTGACTG
Actb ACAGCAGTTGGTTGGAGCAA ACGCGACCATCCTCCTCTTA