Skip to main content

Table 1 Quantitative real-time polymerase chain reaction (qRT-PCR) primer sequences

From: Enhancing therapeutic efficacy of human adipose-derived stem cells by modulating photoreceptor expression for advanced wound healing

Gene Primer Sequence (5′–3′)
Human GAPDH Forward GTCGGAGTCAACGGATTTGG
Reverse GGGTGGAATCAATTGGAACAT
Human OPN3 Forward CATTGCTATGGCCATATTCTATATTCCATTCG
Reverse ATCATTAAAAAGCACATTTTGGCCAGTTTC
Human OPN4 Forward GTTGCTGACATCCTGCTCCT
Reverse TCCCGGATGGCCCTGAAGAT
Human PLC-β Forward CTGGATGAAAAGCCCAAGCTG
Reverse ATTGCTGTCTTCACTGATCTTTCCT
Human IP3R Forward GGTTGGAGACTATCAGCTCGCT
Reverse GCATCATTGGGCTGAACTGGTG
Human C-MYC Forward AATGAAAAGGCCCCCAAGGTAGTTATCC
Reverse GTCGTTTCCGCAACAAGTCCTCTTC
Human CXCL12 Forward TGCCAGAGCCAACGTCAAG
Reverse CAGCCGGGCTACAATCTGAA
Human CXCR4 Forward TGCTTGCTGAATTGGAAGTG
Reverse AGTCATAGTCCCCTGAGCCC
Human β-CATENIN Forward TTGTGCGGCGCCATTTTAAG
Reverse TCCTCAGACCTTCCTCCGTC
Human INTEGRIN α5 Forward TGCAGTGTGAGGCTGTGTACA
Reverse GTGGCCACCTGACGCTCT
Human INTEGRIN β1 Forward GCCGCGCGGAAAAGATGAAT
Reverse CACAATTTGGCCCTGCTTGTA
Human VEGF Forward GAGGGCAGAATCATCACGAAGT
Reverse CACCAGGGTCTCGATTGGAT
Human HGF Forward GATGGCCAGCCGAGGC
Reverse TCAGCCCATGTTTTAATTGCA
Human KI67 Forward TGACCCTGATGAGAAAGCTCAA
Reverse CCCTGAGCAACACTGTCTTTT
Human PCNA Forward CCTGCTGGGATATTAGCTCCA
Reverse CAGCGGTAGGTGTCGAAGC
Mouse β-Actin Forward GGCTGTATTCCCCTCCATCG
Reverse CCAGTTGGTAACAATGCCATGT
Mouse Acta2 Forward CAGGCATGGATGGCATCAATCAC
Reverse ACTCTAGCTGTGAAGTCAGTGTCG
Mouse Cd31 Forward CAAACAGAAACCCGTGGAGATG
Reverse ACCGTAATGGCTGTTGGCTTC
Mouse Laminin Forward TCCTGCCCACATCAAACAGA
Reverse GTAGGTCAAAGGCTCGGCTC