Skip to main content

Table 1 Primer sequence used in Cell diffusion assays

From: Preclinical study of human umbilical cord mesenchymal stem cell sheets for the recovery of ischemic heart tissue

Primer Sequence
D18S51-F TTCTTGAGCCCAGAAGGTTA
D18S51-R GCTACTATGGACTAATATTAGTTTGG
MUS-ACTB-F ATCGCCATTTTTGTGCTCTT
MUS-ACTB-R ATTGAAATGATGGCTTTCGC