Skip to main content

Table 1 Primer sequences for qRT-PCR

From: Mesenchymal stem cells-derived small extracellular vesicles alleviate diabetic retinopathy by delivering NEDD4

Gene Sequence (5’-3’) Tm (°C) Size (bp)
Rat-β-actin F: GACCTGTACGCCAACACAGT
R: CTCAGGAGGAGCAATGATCT
59 129
Rat-GPX1 F: AATCAGTTCGGACATCAGGAG
R: GAAGGTAAAGAGCGGGTGAG
55 150
Rat-HO-1 F: CTGCTAGCCTGGTTCAAGATACT
R: TAAATTCCCACTGCCACGGT
58 142
Rat-NQO1 F: TGGCCAATTCAGAGTGGCATT
R: AGAGTGGTGACTCCTCCCAG
60 157
Rat-GCLC F: GCCGTCTTACAGGGGATGTT
R: ACGCCTTCCTTCCCATTGAT
58 158
Rat-GCLM F: GTGGGCACAGGTAAAACCCAA
R: ACTTGCCTCAGAGAGCAGTTC
60 145