Skip to main content

Table 2 Sequence of primers used for quantitative RT-PCR

From: Anti-fibrotic effect of a selective estrogen receptor modulator in systemic sclerosis

Target name Direction Primer sequence Size
hOCT4 Forward ACCCCTGGTGCCGTGAA 190
  Reverse GGCTGAATACCTTCCCAAATA  
hCD44 Forward AAGGTGGAGCAAACACAACC 151
  Reverse AGCTTTTTCTTCTGCCCACA  
hCOL1A1 Forward CCCCTGGAAAGAATGGAGATG 148
  Reverse TCCAAACCACTGAAACCTCTG  
hCOL1A2 Forward GGATGAGGAGACTGGCAACC 77
  Reverse TGCCCTCAGCAACAAGTTCA  
hCOL3A1 Forward CGCCCTCCTAATGGTCAAGG 161
  Reverse TTCTGAGGACCAGTAGGGCA  
hVimentin Forward GAGAACTTTGCCGTTGAAGC 170
  Reverse TCCAGCAGCTTCCTGTAGGT  
hPAX6 Forward GTCCATCTTTGCTTGGGAAA 110
  Reverse TAGCCAGGTTGCGAAGAACT  
hSOX1 Forward CACAACTCGGAGATCAGCAA 133
  Reverse GGTACTTGTAATCCGGGTGC  
hNp63 Forward GGAAAACAATGCCCAGACTC 294
  Reverse GTGGAATACGTCCAGGTGGC  
hKRT5 Forward ACCGTTCCTGGGTAACAGAGCCAC 198
  Reverse GCGGGAGACAGACGGGGTGATG  
hKRT14 Forward GCAGTCATCCAGAGATGTGACC 181
  Reverse GGGATCTTCCAGTGGGATCT  
hGAPDH Forward ACCCACTCCTCCACCTTTGA 110
  Reverse CTGTTGCTGTAGCCAAATTCGT  
mCOL1A1 Forward GCAACAGTCGCTTCACCTACA 138
  Reverse CAATGTCCAAGGGAGCCACAT  
mCOL3A1 Forward TGAGCGTGGCTATTCCTTCGT 76
  Reverse GCCGTGGCCATCTCATTTTCAA  
mACTA2 Forward GTTCTAGAGGATGGCTGTACTA 108
  Reverse TTGCCTTGCGTGTTTGATATTC  
mGAPDH Forward ACCCCAGCAAGGACACTGAGCAAG 92
  Reverse TGGGGGTCTGGGATGGAAATTGTG