Skip to main content

Table 1 Primer pairs used for reverse transcriptase polymerase chain reaction

From: MicroRNA-20b and ERK1/2 pathway independently regulate the expression of tissue factor in hematopoietic and trophoblastic differentiation of human embryonic stem cells

Gene symbol Forward primer (5′ to 3′) Reverse primer (5′ to 3′)
Oct-4 CTTGGGCTACACAGGC CTCAATACTCGTTCGCTTTC
Nanog TTTGGAAGCTGCTGGGGAAG GATGGGAGGAGGGGAGAGGA
CDX2 CCGAACAGGGACTTGTTTAGAG CTCTGGCTTGGATGTTACACAG
TF ACGCTCCTGCTCGGCTGGGT CGTCTGCTTCACATCCTTCA
GAPDH GGAGCCAAAAGGGTCATC CCAGTGAGTTTCCCGTTC