Skip to main content

Table 1 Reverse transcription-polymerase chain reaction primer sequences

From: Human ethmoid sinus mucosa: a promising novel tissue source of mesenchymal progenitor cells

Primer name Sequence (5′-3′) Size (bp)
GAPDH Sense: GGACTCATGACCACAGTCCATGCC 152
  Antisense: TCAGGGATGACCTTGCCCACA  
LPL Sense: GAGATTTCTCTGTATGGCACC 276
  Antisense: CTGCAAATGAGACACTTTCTC  
PPARγ Sense: TGAATGTGAAGCCCATTGAA 161
  Antisense: CTGCAGTAGCTGCACGTGTT  
ALP Sense: TGGAGCTTCAGAAGCTCAACACCA 454
  Antisense: ATCTCGTTGTCTGAGTACCAGTCC  
OC Sense: ATGAGAGCCCTCACACTCCTC 294
  Antisense: GCCGTAGAAGCGCCGATAGGC  
AGN Sense: TGCGGGTCAACAGTGCCTATC 182
  Antisense: CACGATGCCTTTCACCACGAC  
COL2A1 Sense: GGAAACTTTGCTGCCCAGATG 167
  Antisense: TCACCAGGTTCACCAGGATTGC  
  1. AGN, aggrecan; ALP, alkaline phosphatase; bp, base pairs; COL2A1, collagen type II α1; GAPDH, glyceraldehydes-3-phosphate dehydrogenase; LPL, lipoprotein lipase; OC, osteocalcin; PPARγ, peroxisome proliferator-activated receptor-gamma.