Skip to main content

Table 1 Primer sequences used for reverse transcription–polymerase chain reaction gene expression analysis

From: Gelatin-chondroitin-6-sulfate-hyaluronic acid scaffold seeded with vascular endothelial growth factor 165 modified hair follicle stem cells as a three-dimensional skin substitute

Gene 5′ to 3′ Primers Production size (base pairs)
CK10 Forward TTGGAAACCTGCAAATAACCC 175
Reverse ATCATAGACGAAAGGACTCTACCC
CK15 Forward AAAACCGTCGGGATGTAGAGG 94
Reverse TTGCTGGTCTGGATCATTTCTGT
CK19 Forward CCAAGTTTGAGACAGAACAGGC 156
Reverse CGTGGTTCTTCTTCAGGTAGGC
CD34 Forward CCTGCCGTCTGTCAATGTTTC 146
Reverse GCACTCCTCGGATTCCTGAAC
Integrin β1 Forward ATCATGCAGGTTGCAGTTTG 72
Reverse CGTGGAAAACACCAGCAGT
Integrin α6 Forward CGTGGTTCTTCTTCAGGTAGGC 188
Reverse CACATCTATGGACGCCCTCAC
ACTB Forward GCTATGTTGCCCTAGACTTCGA 173
Reverse GATGCCACAGGATTCCATACC
VEGF165 Forward CACCCACCCACATACATACA 169
Reverse CTCCCAACTCAAGTCCACA
β-actin Forward GTCCCTCACCCTCCCAAAAG 20
Reverse GCTGCCTCAACACCTCAACCC 21