Fluid-induced, shear stress-regulated extracellular matrix and matrix metalloproteinase genes expression on human annulus fibrosus cells

Table 2 Primers used in the real-time polymerase chain reaction analysis

Target gene	Forward primer	Reverse primer	GenBank	Roche
Target gene	Forward primer	Reverse primer	accession no.	probe no.
Housekeeping gene
GAPDH	agccacatcgctcagacac	gcccaatacgaccaaatcc	NM_002046	#60
Anabolic genes
COLIA1	gggattccctggacctaaag	ggaacacctcgctctcc	NM_000088	#67
COLIIIA1	ctggaccccagggtcttc	catctgatccagggtttcca	NM_000090	#20
Aggrecan	cctccccttcacgtgtaaaa	gctccgcttctgtagtctgc	NM_01135	#76
Catabolic genes
MMP-1	gctaacctttgatgctataactacga	tttgtgcgcatgtagaatctg	NM_001145938.1	#7
MMP-3	caaaacatatttctttgtagaggacaa	ttcagctatttgcttgggaaa	NM_002422	#36
ADAMTS-4	ccaggcactgggctactact	gaacagggggtcccatcta	NM_005099	#67

ADAMTS-4 A disintegrin and metallopeptidase with thrombospondin motif 4, COLIA1 Collagen type IA1, COLIIIA1 Collagen type IIIA1, GAPDH Glyceraldehyde-3-phosphate dehydrogenase, MMP Matrix metalloproteinase

ISSN: 1757-6512