Cell cultures
We employed the parental telomerised cell line hMSC-TERT (subclone hMSC-TERT4) described previously [20]. To visualize the cells when implanted in vivo, we created a sub-line from hMSC-TERT4, overexpressing firefly luciferase (LUC2) and termed hMSC-LUC2.
Stable retroviral transfection using the firefly luciferase gene LUC2
The LUC2 gene was polymerase chain reaction (PCR)-amplified from the pGL4.10 plasmid by using Phusion Hot Start High-Fidelity DNA Polymerase (Thermo Fisher Scientific, Waltham, MA, USA) in accordance with the instructions of the manufacturer. The primers sequences were as follows: forward primer: CATCAGCCAGCCCACCGTCG and reverse primer: CGGTCGAAGCTCTCGGGCAC.
The PCR products were purified with the SV gel and PCR clean-up system (Promega, Nacka, Sweden) and ligated into the retroviral vector pBABEpuro, which was pre-digested with the SnaBI (blunt) restriction enzyme. The plasmid was then transformed into DH5α cells. Positive clones were identified by purifying the vector by using a Wizard® Plus SV Minipreps DNA Purification System (Promega) in accordance with the instructions of the manufacturer. After purification, the plasmid was linearized and analyzed on a 0.5 % agarose gel for 90 min at 70 V. Finally, the inserts were confirmed by sequencing.
Virus generation and transfection
Phoenix A packaging cells (70–80 % confluent), cultured in six-well plates, were transfected with the pBABE-LUC2 construct (3 μg/well) by using the FuGENE 6 (Roche, Hvidovre, Denmark) method in accordance with the instructions of the manufacturer. The supernatants, from 25 cm2 of Phoenix A packaging cells containing virus particles, were collected 24 and 48 h after transfection, filtered with a 0.45-μm filter, diluted 1:1 with the culture medium, and added to the hMSC-TERT cell line, in a 25-cm2 flask supplemented with 6 μg/ml Polybrene for infection. Twenty-four hours after the second round of infection, 3 μg/ml puromycin was added for selection, and the selection pressure was maintained until all non-transfected control cells were eradicated. The puromycin-resistant cells were expanded and maintained in medium supplemented with 0.2 μg/ml puromycin. An estimated 500,000 cells initially survived the selection to make the respective cell line (termed hMSC-LUC2).
CD146 cell sorting
The hMSC-LUC2, was used for all experiments. hMSC-LUC2 cells were sorted on a FACSdiva (BD Biosciences, Brøndby, Denmark) into positive (hMSC-CD146+) and negative (hMSC-CD146–) cell populations using incubation with a PE pre-conjugated CD146 antibody (BD Pharmingen, Brøndby, Denmark). Briefly, hMSC-LUC2 cells were trypsinized to a single-cell suspension, washed in phosphate-buffered saline (PBS) with 0.5 % bovine serum albumin (BSA), and incubated with CD146 antibody diluted in PBS with 0.5 % BSA for 30 min on ice. Cells were then sorted into distinct populations on a FACSAria cell sorter (BD Biosciences) and re-cultured for future in vitro and in vivo experiments. Cell expansion was performed in basal media (minimum essential medium) (Invitrogen, Taastrup, Denmark with 10 % fetal bovine serum (FBS); PAA, Pasching, Austria).
Cell proliferation
Cell proliferation was monitored by determining the number of population doublings by using the formula: logN/log2, where N is the cell number of the confluent monolayer divided by the initial number of seeded cells.
Cell differentiation
For osteoblast differentiation, the cells were cultured in osteoblastic induction media (OIM) comprised of basal media supplemented with 10 mM β-glycerophosphate (Calbiochem-Merck, Darmstadt, Germany), 50 μg/ml L-ascorbic acid-2-phosphate (Wako Chemicals GmbH, Neuss, Germany), 10 nM dexamethasone (Sigma-Aldrich, Brøndby, Denmark), and 10 nM calcitriol (1.25-dihydroxy vitamin-D3 (1,25 (OH)2D3) kindly provided by Leo Pharma, Ballerup, Denmark). For adipocyte differentiation, the cells were cultured in adipocytic induction media (AIM) containing basal media supplemented with 10 % horse serum (Sigma-Aldrich), 100 nM dexamethasone (Sigma-Aldrich), 500 μM 1-methyl-3-isobutylxanthine (IBMX) (Sigma-Aldrich), 1 μM Rosiglitazone (BRL49653; Cayman Chemical, Ann Arbor, MI, USA), and 5 μg/ml insulin (Sigma-Aldrich). Samples undergoing induction were collected at days 5, 10, and 15. Three independent experiments were performed for each differentiation assay.
Flow cytometry
Flow cytometry was performed by using a FACScan (BD Biosciences). To confirm the profile of either hMSC-TERT versus hMSC-LUC2 or hMSC-CD146+ and hMSC-CD146– populations, cells were trypsinized to a single-cell suspension, washed in PBS + 0.5 % BSA, and incubated with an antibody (in PBS + 0.5 % BSA) for 30 min on ice. After incubation, excess antibody was washed out by using PBS and cells analyzed on the FACSCalibur (BD Biosciences) flow cytometer and data analyzed by using WinMDI (The Scripps Institute, Flow Cytometry Core Facility). Sorted and unsorted cell populations were profiled using a number of known MSC pre-conjugated fluorescence-activated cell sorting (FACS) markers: CD14-FITC, CD34-PE, CD44-PE, CD63-FITC, CD73-PE, and CD146-PE (all BD Pharmingen) and CD105-APC (eBioscience, Hatfield, UK).
Alkaline phosphatase activity and cell viability
Cell viability was measured by using CellTiter-Blue Cell Viability assay in accordance with the instructions of the manufacturer (Promega). ALP activity was determined by using a 1 mg/ml solution of P-nitrophenylphosphate (Sigma-Aldrich) in 50 mM NaHCO3 with 1 mM MgCL2, pH 9.6, at 37 °C for 20 min; activity was then stopped with 3 M NaOH. Plates were read by using a FLUOstar Omega plate reader (BMG Laboratories, Ramcon A/S, Birkerod, Denmark), and ALP activity was corrected for cell number.
Cytochemical staining
Cells undergoing osteoblastic or adipocytic induction were stained at days 5, 10, and 15 for ALP and alizarin red or Oil red O (ORO), respectively, as previously described [21]. Elution of ORO staining was performed by using 100 μl of isopropanol for 10 min at room temperature; 60 μl was then removed to a 96-well plate and read on a FLUOstar Omega plate reader set at 500 nm emission wavelength.
Cell morphology analysis by high-content imaging
hMSC-CD146+ and hMSC-CD146− cells were seeded in 96-cell carrier well plates (PerkinElmer, Waltham, MA, USA) and cultured in standard medium. The adherent cells were washed with PBS−/−, fixed in 4 % formaldehyde for 10 min at room temperature, and washed three times with PBS. Cells were stained for alpha tubulin, Phalloidin-TRITC, and Hoechst 33342 (all Sigma-Aldrich) by using Alexafluor 488 (Thermo Fisher Scientific) as the secondary antibody for alpha tubulin. Plates were scanned in the Operetta (PerkinElmer) and cells (>1000 per cell line) analyzed for cell size and shape and changes in microtubule (F-actin) thickness using the Harmony software (PerkinElmer) and texture analysis using SER (saddle, edge, ridge) features to measure changes in structure within the cell. Both the ‘Valley’ and ‘Ridge’ patterns from the SER features were selected by using a 2px width to assess spaces or ridge height of the F-actin fibres.
Boyden chamber transwell migration assay
The migration ability of sorted cells was measured in a 48-well micro-chemotaxis Boyden chamber-based cell migration assay (8-μm pore polycarbonate membrane; Neuro Probe, Inc., Gaithersburg, MD, USA). The membrane was coated for 1 h at 37 °C in migration media—low glucose Dulbecco’s modified Eagle’s medium (Invitrogen), with 0.2 % FBS (Sigma-Aldrich)—supplemented with 5 μg/ml Fibronectin and 10 μg/ml rat-tail collagen I. The cells were cultured in migration media for 24 h prior to migration initiation. The chemotaxis and control media (27 μl) were placed in the lower chamber. The chamber was covered by the coated membrane and fixed by the upper chamber. Fifty-microliter sorted cells (2.5 × 105 cells/ml migration media) were loaded into the upper chamber wells and incubated for 4 h at 37 °C. Non-migrated cells on the upper side of the membrane were scraped and rinsed with cold PBS. Migrated cells on the lower side of the membrane were fixed and stained with a hemacolor® staining kit (Merck) and imaged on an inverted microscope (×20 magnification). Images were captured of the entire wells, and cells were counted by using the ImageJ program. Results were expressed as mean number of cells for six technical replicates (n = 2 independent experiments).
Gene expression analysis
Total RNA was extracted from samples collected at days 0, 5, 10, and 15 of induction from unsorted and sorted populations by using TRIzol (Invitrogen) in accordance with the instructions of the manufacturer. cDNA was synthesized by using a revertAid H minus first-strand cDNA synthesis kit (Fermentas, St Leon-Rot, Germany). Reverse transcription-polymerase chain reaction (RT-PCR) was performed on an ABI StepOne™ Real-Time PCR machine (Life Technologies/Applied Biosystems), and data analyzed by using Excel (Microsoft Corporation, Redmond, WA, USA). Ten micrograms of cDNA was used in each reaction in combination with 2× Fast SYBR green master mix (Applied Biosystems). Primers were purchased from DNA Technology A/S (Risskov, Denmark) or Eurofins (Ebersberg, Germany) and included Collagen 1a1 (COL1a1), RUNX2, alkaline phosphatase (ALPL), osteocalcin (BGLAP), osteonectin (SPARC), osteopontin (OPN), the long and short forms of CD146 (lgCD146, shCD146), CD146, elastin (ELN), decorin (DCN), and biglycan (BGN) for osteogenic differentiation and adipocyte-specific lipid binding protein 2 (aP2), PPARγ2, lipoprotein lipase (LPL), adiponectin (ADIPOQ), and C/CEBPα for adipogenic differentiation. Cycle threshold (CT) values were normalized against β-actin and analysis was performed by using the comparative CT method. Statistical analysis to detect differences between gene expression levels was carried out by using Student’s t test. Primers used in these studies can be found in Additional file 1: Table S1.
In vivo heterotopic bone formation assay
The cells were trypsinized to a single-cell suspension and seeded onto 40 mg Triosite (HA/TCP, 0.5- to 1-mm granules; Biomatlante/Zimmer, Vigneux de Bretagne, France) and kept overnight at 37 °C, 5 % CO2. HA/TCP granules in combination with cells were then implanted subcutaneously (four implants per cell line) in the dorso-lateral area of immune-compromised (NOD.CB17-Prkdc
scid/J) mice (The Jackson Laboratory, Bar Harbor, ME, USA) for 8 weeks. Ethical approval for subcutaneous implantations was granted by the Danish National Animal Experiment Inspectorate (2012-DY-2934-00006). The implants were removed, fixed in formalin, decalcified using formic acid for 3 days or 0.4 M ethylenediaminetetraacetic acid (EDTA) for 12 days, embedded, and sectioned. Four serial sections were cut at three different tissue depths with 100 μm distance between each group. Staining was performed with hematoxylin and eosin (three sections) or human-specific Vimentin (#RM-9120, Clone SP20; Thermo Fisher Scientific: one section). Additional staining was performed by using tartrate-resistant acid phosphate (TRAP) staining on implants which underwent 0.4 M EDTA decalcification. In brief, 50 ml acetate buffer pH 5.2 with 115 mg sodium tartrate and 70 mg Fast Red Salt TR (Sigma-Aldrich, F2768) was mixed with 70 mg napthol AS-TR phosphate (Sigma-Aldrich, N6125) dissolved in 250 μl N-N-dimethylformamide to produce the staining solution. The slides with tissue sections were deparaffinized in xylene and processed through increasing alcohol concentrations before being incubated in the staining solution for 2 h at 37 °C. Sections were briefly counterstained in Mayer’s hematoxylin before rinsing in tap water and mounting under coverslips with an aqueous mounting medium.
Quantification of heterotopic bone formation and bone marrow
Mosaic images of serial sections were obtained by using Surveyor (Objective Imaging, Cambridge, UK). Using the free-hand contouring tool from PhotoShop (Adobe, CS4), the tissue area of each implant was calculated. Using the Magic wand-tool, the bone or BM areas were highlighted and the areas calculated; data were then calculated as a percentage of bone or BM/tissue area of the implant (nine sections per implant).
In vivo migration assay
A closed fracture was created in 10 immunodeficient (NOD.CB17-Prkdc
scid/J; The Jackson Laboratory) 8-week-old, sedated, female mice (100 mg/kg ketamine hydrochloride and 5 mg/kg xylazine hydrochloride) as described by Bonnarens and Einhorn [22]. Ethical approval for femoral fracture was granted by the Danish National Animal Experiment Inspectorate (2012-15-2934-00559). Fractures were created by using a guillotine apparatus on the right hind limb following insertion of a 0.5-mm needle. Fracture and pinning were confirmed by x-ray (Faxitron MX-20). Three hours after fracture, single-cell suspended hMSC-CD146+ or hMSC-CD146– cells were tail vein-injected at 1 × 106 cells per 100 μl of PBS/injection into five mice per cell line and bioluminescence imaged at 30 min post-injection (d0), d1, d3, and d6.
Bioluminescence imaging
The Xenogen IVIS Spectrum (PerkinElmer) was used to obtain images of bioluminescence. Ten to 15 minutes prior to imaging, immunodeficient mice, tail vein-injected with either hMSC-CD146+ or hMSC-CD146− cells, were injected intraperitoneally with D-luciferin (PerkinElmer, 150 mg/kg body weight in sterile PBS without Mg2+ and Ca2+) and then sedated with 2.5 % isoflurane in oxygen. Images were obtained with field-of-view 13.2 cm, binning factor 8, F/Stop 1, and automatic exposure time by using Xenogen Living Image™ software (version 2.11) overlay (PerkinElmer). Radiance was plotted by using calibrated measurements of photon emission and displayed in units of photons/second/cm2/steradian.
Statistical analysis
Three independent in vitro experiments were performed, and data were presented as mean ± standard deviation. Statistical analysis were performed by using a one-way analysis of variance where group size was 3 or more, and for group sizes of 2, Student’s t test was applied (*P < 0.05, **P < 0.005 or P < 0.01, ***P < 0.0001).